2024 Atf4 kda

Atf4 kda

Author: zuyx

August undefined, 2024

WebAll lanes : Anti-ATF6 antibody (ab83504) at 1 µg/ml Lane 1 : Wild-type HeLa cell lysate Lane 2 : ATF6 knockout HeLa cell lysate Lysates/proteins at 20 µg per lane. Performed under reducing conditions. Predicted band size: 75 kDa Observed band size: 95 kDa why is the actual band size different from the predicted? Lanes 1- 2: Merged signal (red and …

Elevated Activating Transcription Factor 4 and Glucose-Regulated 78 Kda ...

WebPurpose: To determine concentrations of endoplasmic reticulum (ER) stress-related factors activating transcription factor 4 (ATF4) and glucose-regulated 78 kDa protein (GRP78) in … WebThis antibody is a rabbit polyclonal antibody raised against full length human ATF4 antigen. The antibody recognizes the 38 kDa ATF4 protein and its phosphorylated forms (50 … gri bellows pump

Pathogens Free Full-Text Varicella-Zoster Virus Infectious …

WebWestern Blot analysis of Rat Brain showing detection of ~39 kDa (isoform 2) ATF4 protein using Mouse Anti-ATF4 Monoclonal Antibody, Clone S360A-24 (SMC-447). Lane 1: Molecular Weight Ladder (MW). Lane 2: Rat Brain. Load: 15 µg. Block: 5% Skim Milk in 1X TBST. Primary Antibody: Mouse Anti-ATF4 Monoclonal Antibody (SMC-447) at 1:1000 … WebMay 31, 2010 · This suggests that the HIF and BCL2/adenovirus E1B 19-kDa protein-interacting protein 3 pathway may be less important under chronic and severe hypoxia … WebWestern blot was performed using Anti-ATF4 Recombinant Rabbit Monoclonal Antibody (SD20-92) (Product # MA5-32364) and a 48 kDa band corresponding to ATF4 was … gribes an

Midazolam activates caspase, MAPKs and endoplasmic …

ATF4 Gene - GeneCards ATF4 Protein ATF4 Antibody

Web1X10^6 HeLa cells were intracellularly stained with 0.4 ug Anti-Human ATF4 (60035-1-Ig, Clone:3E4C5) and CoraLite®488-Conjugated AffiniPure Goat Anti-Mouse IgG (H+L) at dilution 1:1000 (red), or 0.4 ug Control Antibody. Cells were fixed and permeabilized with Transcription Factor Staining Buffer Kit (PF00011). WebTM3 cells were treated without or with different concentrations of midazolam (150 and 300 μM) for 3, 6, 12 and 24 hours. PERK (140 kDa), phosphor-EIF2α (38 kDa), EIF2α (36 kDa), ATF4 (49 kDa), ATF3 (21 kDa) and CHOP (30 kDa) were detected by Western blot analysis (A). Immunoblot represents the observations from one single experiment repeated ... field trips in phoenixWebThe transcription factor ATF4 enhances bone formation by favoring amino acid import and collagen synthesis in osteoblasts, a function requiring its phosphorylation by RSK2, the kinase inactivated in Coffin-Lowry Syndrome. ... Ribosomal Protein S6 Kinases, 90-kDa / metabolism Substances Amino Acids Atf4 protein, mouse Dietary Proteins ... field trips in sioux falls

"WebHowever, CS-11815 detects a band with a mass of ~49 kDa, while the expected molecular weight of ATF4 is ~38 kDa. In contrast, SC-200 is a very dirty polyclonal antibody, but it seems to detect ATF4 as both a ~49 kDa band and a ~38 kDa band. I'm unaware of any long ATF4 splice variants or PTMs that might be responsible for this difference. " - Atf4 kda

Atf4 kda

Regulation of autophagy by ATF4 in response to severe hypoxia

WebMay 15, 2015 · ATF4 is a transcription factor whose mRNA translation is stimulated in response to stress-activated eIF2alpha kinases. Established conditions that activate eIF2alpha phosphorylation and ATF4 translation include excessive stress in the endoplasmic reticulum (ER) and amino acid deprivation. ... The resulting ~50 kDa His … WebWestern blot: Approx 35-37 kDa band observed in Mouse Heart lysates (calculated MW of 38.3 kDa according to Mouse NP_001274109.1; NP_033846.2). ... ATF4 is a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV1. The encoded ...

Did you know?

WebMay 12, 2024 · ABSTRACT. Purpose: To determine concentrations of endoplasmic reticulum (ER) stress-related factors activating transcription factor 4 (ATF4) and glucose-regulated 78 kDa protein (GRP78) in vitreous and aqueous humor (AqH) of patients with proliferative diabetic retinopathy (PDR) and the correlation of ATF4, GRP78 and inflammatory … WebFeb 28, 2006 · AMSOIL Synthetic Universal ATF / ATF+, ATF+2, ATF+3, ATF+4 _____ Maybe this helps ..... ONLY ATF+4 (or you can consider AMS OIL Synthetic Universal …

WebChromatin immunoprecipitations were performed with cross-linked chromatin from mouse embryonic fibroblasts treated with tunicamycin (2ug/ml) overnight, and ATF-4 (D4B8) … WebWestern blot was performed using Anti-ATF4 Polyclonal Antibody (Product # PA5-19521) and a 48 kDa band corresponding to ATF4 was observed across cell lines tested. Whole cell extracts (30 µg lysate) of MCF7 (Lane 1), MCF7 treated with 2 µM Thapsigargin for 8 hours (Lane 2), HeLa (Lane 3) and HeLa treated with 2 µg/ml Tunicamycin for 8 hours ...

WebMar 21, 2024 · ATF4 (Activating Transcription Factor 4) is a Protein Coding gene. Diseases associated with ATF4 include Coffin-Lowry Syndrome and Fatty Liver Disease.Among its … WebImmunoprecipitation of ATF-6 from 293T cell extracts. Lane 1 is 10% input, lane 2 is Rabbit (DA1E) mAb IgG XP ® Isotype Control #3900, and lane 3 is ATF-6 (D4Z8V) Rabbit mAb. …

WebDuring the UPR, PERK can phosphorylate eIF2α, the 90-kDa precursor of ATF6 is cleaved into a 50-kDa protein that functions as a transcription factor, and IRE1 splices a 26-bp intron from Xbp1u, resulting in an active Xbp1s. ... ATF4-F: ATGACCGAAATGAGCTTCCTG: ATF4-R: GCTGGAGAACCCATGAGGT: GADD34-F: GGAGGAAGAGAATCAAGCCA: …

WebAntibody concentration 10 ug/ml. Western Blot: ATF4 Antibody (2B3) [H00000468-M01] - Western Blot analysis of ATF4 expression in NIH/3T3 ( Cat # L018V1 ). ELISA: ATF4 Antibody (2B3) [H00000468-M01] - Detection limit for recombinant GST tagged ATF4 is approximately 0.03ng/ml as a capture antibody. field trips in spanishWeb1X10^6 HeLa cells were intracellularly stained with 0.4 ug Anti-Human ATF4 (60035-1-Ig, Clone:3E4C5) and CoraLite®488-Conjugated AffiniPure Goat Anti-Mouse IgG (H+L) at … field trips in south carolinaWebDec 28, 2024 · The Golgi apparatus is involved in the intracellular transport and maturation of proteins and lipids (Rohn et al., 2000; Viotti, 2016).More than a third of all human genes are known to encode proteins that travel through the Golgi (Yuen et al., 1997).The Golgi has a distinctive structure with several layers of flat, semicircular vesicles known as cisternae. gribe anWebDec 10, 2016 · C/EBP-homologous protein, CHOP or GADD153 (growth arrest and DNA damage 153), is another protein induced under conditions of severe ER stress by XBP1 and ATF4 (another UPR component). The 29 kDa CHOP is a member of the C/EBP family of transcription factors. field trips in nycWebAll lanes : Anti-ATF6 antibody (ab83504) at 1 µg/ml Lane 1 : Wild-type HeLa cell lysate Lane 2 : ATF6 knockout HeLa cell lysate Lysates/proteins at 20 µg per lane. Performed under … grib files downloadWebER stress induces vascular calcification by increasing release of Grp78-loaded EVs. Our results reveal a novel mechanism of action of warfarin, involving increased EV release via the PERK-ATF4 pathway, contributing to calcification. This study is the first to show that warfarin induces ER stress and … grib files pythonWebCadmium exposure causes endoplasmic reticulum (ER) stress and accumulation of activating transcription factor 4 (ATF4), an ER stress marker. To elucidate the role of … field trips kcmo